Welcome to IDT Biophysics

Owczarzy R, Moreira BG, You Y, Behlke MA, Walder JA (2008) Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry, 47: 5336-5353.

This is a copy of the table from the publication. When you click on the specific melting temperature, you will obtain average melting profile (fraction of melted bases pairs versus temperature).

Table 1. Experimental melting temperatures for an additional 18 DNA duplex oligomers in buffers of a wide range of magnesium concentrations.
DNA sequence (5′ to 3′) Tm (oC) at [Mg2+] indicateda
0.5mMb 1.5mMb 3.0mMb 10mMb 20mMb 50mMc 125mMc 300mMc 600mMc
aCt = 2 ± 0.2 µM. Buffers do not contain any KCl. b2mM Tris-HCl buffers. c10mM Tris-HCl buffers.
TTGTAGTCAT 27.2 30.9 32.3 34.9 36.0 37.3 37.5 37.1 35.4
ATCGTCTGGA 35.1 38.9 40.6 43.4 43.4 43.7 44.4 43.0 41.6
GATGCGCTCG 44.0 47.7 48.8 50.7 51.2 51.6 51.9 49.9 47.7
GGGACCGCCT 48.3 51.9 53.7 55.5 55.9 55.4 56.1 54.9 52.2
CGTACACATGC 40.2 44.2 45.7 48.1 48.0 48.1 48.6 47.0 44.9
CCATTGCTACC 38.9 42.7 44.2 46.3 46.9 47.2 47.5 47.0 44.8
TTCTACCTATGTGAT 43.3 46.1 47.8 50.2 50.4 51.0 51.5 50.7 49.4
GCAGTGGATGTGAGA 52.3 55.1 56.5 58.1 58.7 59.2 59.0 58.2 56.1
CAGCCTCGTCGCAGC 61.9 64.1 65.3 66.8 67.3 67.5 67.3 65.5 63.7
TGATTCTACCTATGTGATTT 51.8 54.6 55.8 57.7 58.2 59.3 59.5 58.8 57.7
AGCTGCAGTGGATGTGAGAA 61.1 63.7 64.8 66.3 66.8 67.7 67.3 66.3 64.7
CAGCCTCGTTCGCACAGCCC 68.9 71.3 72.3 73.4 73.9 74.2 73.9 72.3 70.3
GTTCTATACTCTTGAAGTTGATTAC 57.2 59.7 60.8 62.4 63.0 63.8 64.0 63.5 62.6
CTGGTCTGGATCTGAGAACTTCAGG 65.6 67.7 68.7 69.8 70.3 70.7 70.6 69.8 68.6
CAGTGGGCTCCTGGGCGTGCTGGTC 73.5 75.3 76.2 77.3 77.6 78.2 77.4 75.9 74.0
CTTAAGATATGAGAACTTCAACTAATGTGT 61.0 63.1 64.1 65.5 66.0 67.1 67.1 66.2 65.2
AGTCTGGTCTGGATCTGAGAACTTCAGGCT 69.8 71.6 72.5 73.6 73.9 74.2 74.4 73.5 72.2
GACCTGACGTGGACCGCTCCTGGGCGTGGT 76.1 77.8 78.6 79.4 79.7 80.0 79.8 78.1 76.4