Welcome to IDT Biophysics

Owczarzy R, Moreira BG, You Y, Behlke MA, Walder JA (2008) Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry, 47: 5336-5353.

This is a copy of the table from the publication. When you click on the specific melting temperature, you will obtain average melting profile (fraction of melted bases pairs versus temperature).

Table 4. Experimental melting temperatures (oC) for 12 DNA duplex oligodeoxynucleotides (Ct = 2 µM) in buffers of various magnesium and monovalent ion (K+, Tris+) concentrations.
DNA sequence (5′ to 3′)   [Mg2+]
(Duplex ID) [Mon+] 0mM 0.5mM 1.5mM 3.0mM 10mM 20mM 50mM 125mM
TTCTACCTATGTGAT 1mM 43.3 46.1 47.8 50.2 50.4
(ODN1) 5mM 42.1 45.6 47.6 49.5 50.4 51.0 51.5
  55mM 39.3 42.5 44.7 46.2 49.1 49.6 51.0 51.5
  105mM 43.8 44.8 45.8 47.1 49.1 50.1 51.1 51.6
  205mM 47.7 48.1 49.9 51.1 51.4
  605mM 52.1 51.9 51.9 51.8 51.7
  1.005M 53.2 53.0 53.0 52.0 51.4
GCAGTGGATGTGAGA 1mM 52.3 55.1 56.5 58.1 58.7
(ODN2) 5mM 51.9 54.7 56.2 58.2 58.8 59.2 59.0
  55mM 49.5 52.5 54.6 56.0 58.0 58.8 59.3 59.1
  105mM 53.8 54.6 55.8 56.6 58.2 58.9 59.4 59.4
  205mM 57.3 57.9 59.1 59.4 59.5
  605mM 61.6 61.3 61.1 60.2 59.5
  1.005M 62.4 62.3 61.7 60.3 59.6
CAGCCTCGTCGCAGC 1mM 61.9 64.1 65.3 66.8 67.3
(ODN3) 5mM 61.1 64.2 65.1 67.2 67.5 67.5 67.3
  55mM 58.9 62.0 64.0 65.2 66.6 67.4 68.1 67.4
  105mM 63.1 63.8 65.0 65.7 67.5 67.5 67.8 67.2
  205mM 66.5 67.0 68.1 67.6 67.3
  605mM 69.9 69.8 69.4 67.9 67.3
  1.005M 70.6 70.3 70.1 68.1 66.9
TGATTCTACCTATGTGATTT 1mM 51.8 54.6 55.8 57.7 58.2
(ODN4) 5mM 51.0 54.5 55.8 58.1 58.5 59.3 59.5
  55mM 47.6 51.1 53.8 55.4 57.9 58.9 59.4 59.5
  105mM 51.9 53.0 54.7 55.4 57.9 58.4 59.5 59.7
  205mM 56.1 57.0 58.7 59.4 59.9
  605mM 61.6 61.7 61.6 60.7 60.3
  1.005M 63.2 63.2 63.0 61.4 60.7
AGCTGCAGTGGATGTGAGAA 1mM 61.1 63.7 64.8 66.3 66.8
(ODN5) 5mM 60.7 63.9 65.1 66.9 67.3 67.7 67.3
  55mM 57.8 61.1 63.2 64.6 65.8 67.1 67.8 67.5
  105mM 62.4 63.3 64.8 65.2 67.0 67.4 67.7 67.7
  205mM 66.4 67.1 68.1 67.5 67.8
  605mM 71.2 71.1 70.7 68.7 68.2
  1.005M 72.3 72.2 71.7 69.7 68.5
CAGCCTCGTTCGCACAGCCC 1mM 68.9 71.3 72.3 73.4 73.9
(ODN6) 5mM 68.7 71.3 72.3 73.8 74.0 74.2 73.9
  55mM 65.0 68.7 70.8 71.9 73.2 74.0 74.2 73.8
  105mM 69.4 70.8 72.0 72.6 74.0 74.2 74.4 73.8
  205mM 73.5 74.0 74.8 74.4 73.9
  605mM 77.6 77.6 77.0 75.2 74.2
  1.005M 78.4 78.2 77.5 75.5 74.3
GTTCTATACTCTTGAAGTTGATTAC 1mM 57.2 59.7 60.8 62.4 63.0
(ODN7) 5mM   56.3 59.4 60.7 62.6 63.1 63.8 64.0
  55mM 50.7 54.6 57.5 59.1 61.5 63.0 63.8 64.2
  105mM 55.9 57.3 58.9 60.0 62.2 63.2 63.9 64.3
  205mM 60.3 61.3 63.1 63.9 64.4
  605mM 66.1 66.2 66.0 65.2 64.9
  1.005M 68.0 67.9 67.5 66.1 65.5
CTGGTCTGGATCTGAGAACTTCAGG 1mM 65.6 67.7 68.7 69.8 70.3
(ODN8) 5mM 65.1 67.6 68.5 70.1 70.3 70.7 70.6
  55mM 60.3 64.5 66.9 68.1 69.7 70.4 70.7 70.8
  105mM 64.9 66.2 68.0 68.8 70.3 70.7 71.0 70.9
  205mM 69.1 70.0 71.2 71.1 71.0
  605mM 74.2 74.1 74.0 72.5 71.6
  1.005M 75.8 75.6 75.2 73.2 72.3
CAGTGGGCTCCTGGGCGTGCTGGTC 1mM 73.5 75.3 76.2 77.3 77.6
(ODN9) 5mM 73.3 75.9 76.6 78.0 78.0 78.2 77.4
  55mM 70.6 73.9 75.6 76.5 77.3 78.1 78.3 78.0
  105mM 74.3 75.6 77.2 77.4 78.7 78.4 78.3 77.8
  205mM 78.2 79.3 79.5 78.2 77.8
  605mM 82.6 82.6 81.9 79.4 78.3
  1.005M 83.4 83.3 82.6 79.8 78.4
CTTAAGATATGAGAACTTCAACTAATGTGT 1mM 61.0 63.1 64.1 65.5 66.0
(ODN10) 5mM 60.5 63.2 64.4 65.9 66.4 67.1 67.1
  55mM 55.2 59.2 61.8 63.4 65.2 66.1 67.3 67.2
  105mM 60.2 61.5 63.0 64.0 66.0 66.6 67.2 67.2
  205mM 64.6 65.3 66.8 67.0 67.3
  605mM 70.4 70.4 70.1 68.5 68.1
  1.005M 72.4 72.0 71.4 69.6 68.5
AGTCTGGTCTGGATCTGAGAACTTCAGGCT 1mM 69.8 71.6 72.5 73.6 73.9
(ODN11) 5mM 68.8 71.6 72.3 73.8 73.9 74.2 74.4
  55mM 64.6 68.5 71.0 72.1 73.8 74.1 74.4 74.7
  105mM 68.9 70.3 72.1 73.0 74.2 74.3 74.9 74.7
  205mM 73.2 74.3 75.1 74.7 74.9
  605mM 78.4 78.2 78.1 76.4 75.6
  1.005M 80.1 79.9 79.4 77.2 76.2
GACCTGACGTGGACCGCTCCTGGGCGTGGT 1mM 76.1 77.8 78.6 79.4 79.7
(ODN12) 5mM 75.9 78.1 79.0 79.8 79.9 80.0 79.8
  55mM 73.2 76.5 78.0 79.0 79.5 80.0 80.3 79.6
  105mM 77.4 78.6 79.7 79.9 80.7 80.6 80.4 79.7
  205mM 81.2 81.8 81.8 80.5 79.9
  605mM 85.6 85.5 84.4 81.9 80.6
  1.005M 86.7 86.3 85.2 82.5 81.0