Welcome to IDT Biophysics

Owczarzy R, Moreira BG, You Y, Behlke MA, Walder JA (2008) Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry, 47: 5336-5353.

This is a shortened version of the table from the publication. When you click on the specific melting temperature, you will obtain average melting profile (fraction of melted bases pairs versus temperature).

Table S1. Experimental melting temperatures of 23 DNA duplex oligomers in Tris-HCl buffers of various magnesium concentrations.
DNA sequence (5′ to 3′) Tm (oC) at 1M Na+ Tm (oC) at [Mg2+] indicateda
0.5mMb 1.5mMb 3.0mMb 10mMb 20mMb 50mMc 125mMc
aCt = 2 ± 0.2 µM. Buffers do not contain any KCl. b2mM Tris-HCl buffers.c10mM Tris-HCl buffers.
10-mers
ATCAATCATA 33.6 22.0 25.6 27.4 29.8 30.8 33.1 33.2
GAAATGAAAG 34.4 24.5 27.4 30.5 31.4 33.8 34.6 35.3
CCAACTTCTT 40.6 30.1 35.3 36.5 39.3 39.8 40.4 40.3
AGCGTAAGTC 40.3 29.7 36.2 37.6 39.3 40.8 42.2 42.4
CGATCTGCGA 49.1 38.4 43.2 44.0 47.6 47.6 47.3 47.6
TGGCGAGCAC 55.3 45.2 49.7 50.6 52.8 53.3 54.2 54.4
30-mers
TTATGTATTAAGTTATATAGTAGTAGTAGT 66.6 55.0 57.5 58.5 60.0 60.6 61.3 61.7
ATTGATATCCTTTTCTATTCATCTTTCATT 70.4 58.8 61.2 62.3 63.8 64.4 65.1 65.6
AAAGTACATCAACATAGAGAATTGCATTTC 73.2 61.5 63.8 64.7 65.9 66.5 67.2 67.5
CTCAACTTGCGGTAAATAAATCGCTTAATC 75.5 64.1 66.1 67.2 68.3 68.8 69.6 69.8
TATTGAGAACAAGTGTCCGATTAGCAGAAA 76.4 65.3 67.4 68.4 69.6 70.1 70.7 70.8
GTCATACGACTGAGTGCAACATTGTTCAAA 76.9 65.5 67.6 68.5 69.8 70.1 70.7 70.8
AACCTGCAACATGGAGTTTTTGTCTCATGC 78.7 67.9 69.9 70.8 71.7 72.3 72.8 72.9
CCGTGCGGTGTGTACGTTTTATTCATCATA 77.6 66.7 68.7 69.6 70.8 71.2 71.6 71.5
GTTCACGTCCGAAAGCTCGAAAAAGGATAC 78.7 68.1 70.2 71.2 72.2 72.7 73.2 73.4
TCGGAGAAATCACTGAGCTGCCTGAGAAGA 80.9 69.0 71.0 71.9 72.9 73.3 73.8 73.7
CTTCAACGGATCAGGTAGGACTGTGGTGGG 80.1 68.3 70.1 71.0 72.0 72.5 72.9 72.9
ACGCCCACAGGATTAGGCTGGCCCACATTG 84.0 73.2 75.0 75.8 76.7 76.9 77.4 77.2
GTTATTCCGCAGTCCGATGGCAGCAGGCTC 84.1 72.9 74.8 75.5 76.6 76.9 77.3 77.0
TCAGTAGGCGTGACGCAGAGCTGGCGATGG 84.6 73.7 75.8 76.0 77.0 77.7 78.0 77.7
CGCGCCACGTGTGATCTACAGCCGTTCGGC 84.5 73.9 75.3 76.0 77.1 77.0 77.4 77.0
GCCCCTCCACTGGCCGACGGCAGCAGGCTC 87.7 77.6 79.1 79.8 80.4 80.8 80.9 80.6
CGCCGCTGCCGACTGGAGGAGCGCGGGACG 88.6 78.7 80.1 80.9 81.1 81.6 81.6 81.2